0 following ∙ 0 followers
Pronouns: She/fae Gender: Female Country: USA Ancestors most likely were... German and Pollock ( DNA test approved ig ) YouTube: Sandra Platt's Phone Account
Settings are not synced across devices.
Show posts containing spoilers
Show posts with sensitive content
Show posts about serious topics
Show reposts
Sus
CTACTACACATATACATCCCTTTAAA
Just a normal conversation between one good legged Liam and Pi's limbless best friend
What if Catlandia didn't form guilds but instead clans??? This is an alternative universe where that exactly happens!! Into the wild but with changes to lore! Clans: Mentioned: Electricclan Torrentclan Unmentioned: Darknessclan Airclan Gorec
Cupid - Jack Stauber Comic ( mega Crossover AU )
The story of B: part 1
Possibly controversial headcanons ig
Number Lore Comic Studio
Alphabet Lore Comic Studio
